In this article, we will cover, how to Reverse the complement of DNA or RNA sequences in Python.
Example:
DNA strand: ATGCCGAGCA Complementary Strand: TACGGCTCGT Reverse-Complementary strand: ACGAGCCGTA
An overview of DNA and RNA as used in Molecular Biology
The genetic material of living organisms is made up of Deoxyribonucleic acid(DNA) or Ribonucleic acid (RNA). The primary structure of DNA and RNA is made up of a sequence of nucleotide bases. The structure of DNA can be a double-stranded or single-stranded sequence of nucleotides(bases). For double-stranded nucleic acids, the nucleotide bases pair in a given rule which is unique to DNA and RNA. For DNA, there exist four types of bases namely; Adenine(A), Thymine(T), Guanine(G), and Cytosine(C). Therefore, DNA can be identified as containing ATGC bases. The pairing of bases in DNA is that Adenine pairs with Thymine(with a double bond) while Guanine Pairs with Cytosine (with a triple bond). i.e A=T and G≡C as shown below.
DNA base pairing. The upper strand is complementary to the downer strand and vice versa
For RNA, all instances of Thymine are replaced by Uracil. This means that for double-stranded RNA, Adenine pairs with Uracil while Guanine pairs with Cytosine A=U and G≡C as shown below:
RNA base pairing. Each strand is a complementary sequence to one another
Reverse Complement of a DNA or RNA
A Reverse Complement converts RNA or DNA sequence into its reverse, complement counterpart. One of the major questions in Molecular Biology to solve using computational approaches is to find the reverse complement of a sequence. This is always done so to work with the reversed-complement of a given sequence if it contains an open reading frame(a region that encodes for a protein sequence during the transcription process) on the reverse strand. One could be interested to verify that the sequence is a DNA or RNA before finding its reverse complement
How to identify if the sequences of DNA and RNA
One of the major tasks in Bioinformatics in computational molecular biology and bioinformatics is to verify if the sequence is DNA or RNA. To do this we can use the set method to verify a sequence.
Method 1: Verify if a sequence is DNA and RNA
Step 1:
In the set method, we convert the input sequence into a set. We combine the set obtained with a reference DNA set(ATGC) or RNA set(AUGC) using the union function of the set. This is done so that the input sequence is rendered valid even if it does not contain all four types of nucleotide bases. For instance, TTTTTTTAAA is a valid DNA even though it contains only two types of bases. Also, UUUUUUUUGGG is a valid RNA.
Python3
def verify(sequence): '''This code verifies if a sequence is a DNA or RNA''' # set the input sequence seq = set(sequence) # confirm if its elements is equal to the # set of valid DNA bases # Use a union method to ensure the sequence is # verified if does not contain all the bases if seq == {"A", "T", "C", "G"}.union(seq): return "DNA" elif seq == {"A", "U", "C", "G"}.union(seq): return "RNA" else: return "Invalid sequence"seq1 = "ATGCAGCTGTGTTACGCGAT"seq2 = "UGGCGGAUAAGCGCA"seq3 = "TYHGGHHHHH"print(seq1 + " is " + verify(seq1))print(seq2 + " is " + verify(seq2))print(seq3 + " is " + verify(seq3)) |
Output:
ATGCAGCTGTGTTACGCGAT is DNA UGGCGGAUAAGCGCA is RNA TYHGGHHHHH is Invalid sequence
Step 2:
This function returns a reverse complement of a DNA or RNA strand.
Python3
def verify(sequence): '''This code verifies if a sequence is a DNA or RNA''' # set the input sequence seq = set(sequence) # confirm if its elements is equal to # the set of valid DNA bases # Use a union method to ensure the # sequence is verified if does not # contain all the bases if seq == {"A", "T", "C", "G"}.union(seq): return "DNA" elif seq == {"A", "U", "C", "G"}.union(seq): return "RNA" else: return "Invalid sequence"def rev_comp_st(seq): '''This function returns a reverse complement of a DNA or RNA strand''' verified = verify(seq) if verified == "DNA": # complement strand seq = seq.replace("A", "t").replace( "C", "g").replace("T", "a").replace("G", "c") seq = seq.upper() # reverse strand seq = seq[::-1] return seq elif verified == "RNA": # complement strand seq = seq.replace("A", "u").replace( "C", "g").replace("U", "a").replace("G", "c") seq = seq.upper() # reverse strand seq = seq[::-1] return seq else: return "Invalid sequence"# test variablesseq1 = "ATGCAGCTGTGTTACGCGAT"seq2 = "UGGCGGAUAAGCGCA"seq3 = "TYHGGHHHHH"print("The reverse complementary strand of " + seq1 + " is " + rev_comp_st(seq1))print("The reverse complementary strand of " + seq2 + " is " + rev_comp_st(seq2))print("The reverse complementary strand of " + seq3 + " is " + rev_comp_st(seq3)) |
Output:
The reverse complementary strand of ATGCAGCTGTGTTACGCGAT is ATCGCGTAACACAGCTGCAT
The reverse complementary strand of UGGCGGAUAAGCGCA is UGCGCUUAUCCGCCA
The reverse complementary strand of TYHGGHHHHH is Invalid sequence
Method 2: Use of if statement
Another method of finding a complementary sequence of DNA or RNA is the use of if statements. The sequence is first verified if it is DNA or RNA. If a sequence is DNA, All instances of A are replaced by T, all instances of T are replaced by A, all instances of G are replaced by C and all instances of C are replaced by G.
Python3
def verify(sequence): '''This code verifies if a sequence is a DNA or RNA''' # set the input sequence seq = set(sequence) # confirm if its elements is equal to # the set of valid DNA bases # Use a union method to ensure the # sequence is verified if does not # contain all the bases if seq == {"A", "T", "C", "G"}.union(seq): return "DNA" elif seq == {"A", "U", "C", "G"}.union(seq): return "RNA" else: return "Invalid sequence"def rev_comp_if(seq): comp = [] if verify(seq) == "DNA": for base in seq: if base == "A": comp.append("T") elif base == "G": comp.append("C") elif base == "T": comp.append("A") elif base == "C": comp.append("G") elif verify(seq) == "RNA": for base in seq: if base == "U": comp.append("A") elif base == "G": comp.append("C") elif base == "A": comp.append("U") elif base == "C": comp.append("G") else: return "Invalid Sequence" # reverse the sequence comp_rev = comp[::-1] # convert list to string comp_rev = "".join(comp_rev) return comp_revseq1 = "ATGCAGCTGTGTTACGCGAT"seq2 = "UGGCGGAUAAGCGCA"seq3 = "TYHGGHHHHH"print("The reverse complementary strand of " + seq1 + " is " + rev_comp_if(seq1))print("The reverse complementary strand of " + seq2 + " is " + rev_comp_if(seq2))print("The reverse complementary strand of " + seq3 + " is " + rev_comp_if(seq3)) |
Output:
The reverse complementary strand of ATGCAGCTGTGTTACGCGAT is ATCGCGTAACACAGCTGCAT
The reverse complementary strand of UGGCGGAUAAGCGCA is UGCGCUUAUCCGCCA
The reverse complementary strand of TYHGGHHHHH is Invalid Sequence
